Transcript: Human NM_173545.3

Homo sapiens aprataxin and PNKP like factor (APLF), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
APLF (200558)
Length:
3823
CDS:
148..1683

Additional Resources:

NCBI RefSeq record:
NM_173545.3
NBCI Gene record:
APLF (200558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173545.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142527 GTTGGGCAACCCAATGAGTAT pLKO.1 1513 CDS 100% 4.950 6.930 N APLF n/a
2 TRCN0000144122 CATCCTGGTGATAGTGATTAT pLKO.1 1339 CDS 100% 13.200 9.240 N APLF n/a
3 TRCN0000167011 GCCCTATAATGCTCTTCATAT pLKO.1 2624 3UTR 100% 13.200 9.240 N APLF n/a
4 TRCN0000121568 CAAAGATAAATCCCAGCTAAA pLKO.1 807 CDS 100% 10.800 7.560 N APLF n/a
5 TRCN0000167835 GCCACTAACTTAATCCTTGAA pLKO.1 3060 3UTR 100% 4.950 3.465 N APLF n/a
6 TRCN0000122074 CCCGTGATTAATTTACCTCAT pLKO.1 541 CDS 100% 4.050 2.835 N APLF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173545.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05189 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05189 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491578 AATCTAAAATACGTGACCGAACCA pLX_317 21.3% 100% 100% V5 n/a
Download CSV