Transcript: Human NM_173642.4

Homo sapiens ribosomal modification protein rimK like family member A (RIMKLA), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RIMKLA (284716)
Length:
10577
CDS:
144..1319

Additional Resources:

NCBI RefSeq record:
NM_173642.4
NBCI Gene record:
RIMKLA (284716)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173642.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130931 CAGGTCATAGGCTCTATGCTT pLKO.1 765 CDS 100% 3.000 4.200 N RIMKLA n/a
2 TRCN0000129324 CAAGGCAAGCAGTTGGCTATT pLKO.1 861 CDS 100% 10.800 8.640 N RIMKLA n/a
3 TRCN0000129728 CAGGATTGCTTCTGAGTTAAA pLKO.1 1289 CDS 100% 13.200 9.240 N RIMKLA n/a
4 TRCN0000130144 CGAACCTGGCTACAACATTAA pLKO.1 1265 CDS 100% 13.200 9.240 N RIMKLA n/a
5 TRCN0000128400 GCAGCATTTAAACCAAATCCT pLKO.1 1334 3UTR 100% 3.000 2.100 N RIMKLA n/a
6 TRCN0000129625 CCTACTGCTTCCCTAGTAGTT pLKO.1 1352 3UTR 100% 0.495 0.347 N RIMKLA n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4184 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173642.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13535 pDONR223 100% 89.4% 89.5% None 1_123del;1047T>C n/a
2 ccsbBroad304_13535 pLX_304 0% 89.4% 89.5% V5 1_123del;1047T>C n/a
3 TRCN0000465970 AAATCCTAGTAACGCCCCAATATA pLX_317 37.8% 89.4% 89.5% V5 1_123del;1047T>C n/a
Download CSV