Transcript: Human NM_173648.4

Homo sapiens coiled-coil domain containing 141 (CCDC141), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CCDC141 (285025)
Length:
9205
CDS:
197..4789

Additional Resources:

NCBI RefSeq record:
NM_173648.4
NBCI Gene record:
CCDC141 (285025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173648.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116681 CGCCATGAGAGACGAGATAAA pLKO.1 2896 CDS 100% 13.200 18.480 N CCDC141 n/a
2 TRCN0000116679 CGGAATCTGAAGGCGCTTAAA pLKO.1 2999 CDS 100% 13.200 9.240 N CCDC141 n/a
3 TRCN0000419991 TGCGGATGCATGCAATGATAA pLKO_005 4012 CDS 100% 13.200 9.240 N CCDC141 n/a
4 TRCN0000116680 CCTGTCTAATGTAACTGTCAT pLKO.1 4438 CDS 100% 4.950 3.465 N CCDC141 n/a
5 TRCN0000116678 GCGGCATTCAAAGAGCAACTT pLKO.1 2249 CDS 100% 4.950 3.465 N CCDC141 n/a
6 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 6684 3UTR 100% 10.800 5.400 Y LOC388949 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173648.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13540 pDONR223 100% 56.9% 56.5% None (many diffs) n/a
2 ccsbBroad304_13540 pLX_304 0% 56.9% 56.5% V5 (many diffs) n/a
3 TRCN0000475195 CATGGACAGCGTTGCGAAAAGGGG pLX_317 17.2% 56.9% 56.5% V5 (many diffs) n/a
Download CSV