Transcript: Human NM_173658.4

Homo sapiens zinc finger protein 660 (ZNF660), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF660 (285349)
Length:
5834
CDS:
334..1329

Additional Resources:

NCBI RefSeq record:
NM_173658.4
NBCI Gene record:
ZNF660 (285349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173658.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017848 CGGTATAGTTCACAGCTTATT pLKO.1 1267 CDS 100% 13.200 18.480 N ZNF660 n/a
2 TRCN0000017851 CGGGCCTTATATCACATCACA pLKO.1 773 CDS 100% 3.000 2.400 N ZNF660 n/a
3 TRCN0000017850 CAGTGGAAAGTCACATCTTAT pLKO.1 678 CDS 100% 13.200 9.240 N ZNF660 n/a
4 TRCN0000017849 CCTGCAACAAATGAGAGAGTT pLKO.1 442 CDS 100% 4.950 3.465 N ZNF660 n/a
5 TRCN0000017852 CTTATTCAACACCAGAGGAAA pLKO.1 1282 CDS 100% 4.950 2.970 N ZNF660 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1138 CDS 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1138 CDS 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 971 CDS 100% 5.625 2.813 Y ZNF625 n/a
9 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 967 CDS 100% 6.000 3.000 Y Zfp612 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173658.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09977 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09977 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477896 TCCACCTTATGCACCGACGTTCCA pLX_317 45.7% 100% 100% V5 n/a
Download CSV