Transcript: Human NM_173791.5

Homo sapiens PDZ domain containing 8 (PDZD8), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PDZD8 (118987)
Length:
9672
CDS:
214..3678

Additional Resources:

NCBI RefSeq record:
NM_173791.5
NBCI Gene record:
PDZD8 (118987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173791.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121923 CAGGGTAAAGTTGCATCTAAA pLKO.1 3709 3UTR 100% 13.200 18.480 N PDZD8 n/a
2 TRCN0000121746 CGTCTTAAAGTTACGTTGTTA pLKO.1 1177 CDS 100% 5.625 7.875 N PDZD8 n/a
3 TRCN0000141729 GCAGTGCTGCAAGATAACTTT pLKO.1 1579 CDS 100% 5.625 7.875 N PDZD8 n/a
4 TRCN0000121717 CCGTCTTAAAGTTACGTTGTT pLKO.1 1176 CDS 100% 4.950 6.930 N PDZD8 n/a
5 TRCN0000140492 GATTCACTACAGAGCAGGCAT pLKO.1 3486 CDS 100% 2.640 3.696 N PDZD8 n/a
6 TRCN0000140280 GAACCCAACATGGTGTGACTA pLKO.1 2760 CDS 100% 4.950 3.960 N PDZD8 n/a
7 TRCN0000421595 CTATTAAGACGGTTGAATTAA pLKO_005 1301 CDS 100% 15.000 10.500 N Pdzd8 n/a
8 TRCN0000140152 GCTCCTAAGGGAGTACCTTTA pLKO.1 375 CDS 100% 10.800 7.560 N PDZD8 n/a
9 TRCN0000121718 CAGGCATTGAAGATATAGAAA pLKO.1 3500 CDS 100% 5.625 3.938 N PDZD8 n/a
10 TRCN0000141154 CGAATAGACAGGACACTGAAA pLKO.1 2902 CDS 100% 4.950 3.465 N PDZD8 n/a
11 TRCN0000142591 GAACCAGATGTTCTCGTTGAA pLKO.1 2044 CDS 100% 4.950 3.465 N PDZD8 n/a
12 TRCN0000141856 GATCAGGAGTTGGAACACAAT pLKO.1 3355 CDS 100% 4.950 3.465 N PDZD8 n/a
13 TRCN0000142592 GCCAAAGATGTCACTTCAGAA pLKO.1 2185 CDS 100% 4.950 3.465 N PDZD8 n/a
14 TRCN0000142554 GAGTTCAAAGATGAGGCACAA pLKO.1 1741 CDS 100% 4.050 2.835 N PDZD8 n/a
15 TRCN0000140122 GATGTGGCTTTAGGATGCCTA pLKO.1 2425 CDS 100% 2.640 1.848 N PDZD8 n/a
16 TRCN0000141058 CAGCAGCATATCAGATGACTT pLKO.1 3633 CDS 100% 4.950 2.970 N PDZD8 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5817 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5817 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173791.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04735 pDONR223 100% 99.9% 100% None 1041C>T n/a
2 ccsbBroad304_04735 pLX_304 0% 99.9% 100% V5 1041C>T n/a
3 TRCN0000492331 TCCCTGAGGAAGGAACTCCTAATC pLX_317 10.8% 99.9% 100% V5 1041C>T n/a
Download CSV