Transcript: Human NM_174908.4

Homo sapiens coiled-coil domain containing 50 (CCDC50), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
CCDC50 (152137)
Length:
8101
CDS:
282..1202

Additional Resources:

NCBI RefSeq record:
NM_174908.4
NBCI Gene record:
CCDC50 (152137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174908.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129420 GCGGGAGAAATCATCTTTGGA pLKO.1 947 CDS 100% 3.000 4.200 N CCDC50 n/a
2 TRCN0000149472 GCTGCATATACTTCTTGGGAT pLKO.1 1430 3UTR 100% 2.640 3.696 N CCDC50 n/a
3 TRCN0000148487 CGCTACAAAGACCTTGAACAA pLKO.1 507 CDS 100% 4.950 3.960 N CCDC50 n/a
4 TRCN0000375162 ACAAGAGATTGAGCATCATTT pLKO_005 386 CDS 100% 13.200 9.240 N Ccdc50 n/a
5 TRCN0000430382 ATGATCACTTGGGCAGTATAA pLKO_005 1375 3UTR 100% 13.200 9.240 N CCDC50 n/a
6 TRCN0000131115 GCCACCTCTATGCTGCATATA pLKO.1 1419 3UTR 100% 13.200 9.240 N CCDC50 n/a
7 TRCN0000328929 AGCTCCAGAAGCGCTACAAAG pLKO_005 496 CDS 100% 10.800 7.560 N Ccdc50 n/a
8 TRCN0000147619 GACCTTTGTAAACTGCCATTT pLKO.1 1462 3UTR 100% 10.800 7.560 N CCDC50 n/a
9 TRCN0000146450 CGACTTCTAATGGCTGAAGAA pLKO.1 900 CDS 100% 4.950 3.465 N CCDC50 n/a
10 TRCN0000129828 CTTGAACAACAAGACTGTGAA pLKO.1 519 CDS 100% 4.950 3.465 N CCDC50 n/a
11 TRCN0000129948 GAACAAGAGATTGAGCATCAT pLKO.1 384 CDS 100% 4.950 3.465 N CCDC50 n/a
12 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 2299 3UTR 100% 13.200 6.600 Y CLDN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174908.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05064 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05064 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465791 CCTTCTTTCCCTGAGATTACTTGT pLX_317 39% 100% 100% V5 n/a
Download CSV