Transcript: Mouse NM_174992.4

Mus musculus small cell adhesion glycoprotein (Smagp), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Smagp (207818)
Length:
1220
CDS:
418..711

Additional Resources:

NCBI RefSeq record:
NM_174992.4
NBCI Gene record:
Smagp (207818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_174992.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249935 AGCGCTCATTGCAGTTGTTAT pLKO_005 519 CDS 100% 13.200 18.480 N Smagp n/a
2 TRCN0000249934 CTCCCTAGTTGACGACCAATA pLKO_005 1002 3UTR 100% 10.800 15.120 N Smagp n/a
3 TRCN0000216507 CTTGATCTTCTTTCACTTGTA pLKO.1 576 CDS 100% 4.950 3.960 N Smagp n/a
4 TRCN0000249938 GAGTACTTCATCTAATGCTTC pLKO_005 697 CDS 100% 4.050 3.240 N Smagp n/a
5 TRCN0000249936 TTCACTTGTACAAGAACAAAG pLKO_005 587 CDS 100% 10.800 7.560 N Smagp n/a
6 TRCN0000190523 GAGAGAAGGAAGAGTACTTCA pLKO.1 686 CDS 100% 4.950 3.465 N Smagp n/a
7 TRCN0000189906 GCAGAGAGAAGGAAGAGTACT pLKO.1 683 CDS 100% 4.950 3.465 N Smagp n/a
8 TRCN0000249937 AGTTGTTATCACCGTGGTGTT pLKO_005 531 CDS 100% 4.050 2.835 N Smagp n/a
9 TRCN0000190398 CAGAGAGAAGGAAGAGTACTT pLKO.1 684 CDS 100% 4.950 2.970 N Smagp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174992.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03810 pDONR223 100% 84.6% 78.5% None (many diffs) n/a
2 ccsbBroad304_03810 pLX_304 0% 84.6% 78.5% V5 (many diffs) n/a
3 TRCN0000466242 TAGCCGCAGAATAACATTGTTGTC pLX_317 100% 84.6% 78.5% V5 (many diffs) n/a
Download CSV