Transcript: Mouse NM_175021.3

Mus musculus sterile alpha motif domain containing 4B (Samd4b), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Samd4b (233033)
Length:
4391
CDS:
261..2324

Additional Resources:

NCBI RefSeq record:
NM_175021.3
NBCI Gene record:
Samd4b (233033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190532 GCGCAGCTATACATTCTGATA pLKO.1 2420 3UTR 100% 4.950 6.930 N Samd4b n/a
2 TRCN0000314256 GCGCAGCTATACATTCTGATA pLKO_005 2420 3UTR 100% 4.950 6.930 N Samd4b n/a
3 TRCN0000189655 CGAGGAGAACATCACCAGTTA pLKO.1 1715 CDS 100% 4.950 3.465 N Samd4b n/a
4 TRCN0000314326 CGAGGAGAACATCACCAGTTA pLKO_005 1715 CDS 100% 4.950 3.465 N Samd4b n/a
5 TRCN0000202339 GAGTCGCAGAATGTCACCAAA pLKO.1 1269 CDS 100% 4.950 3.465 N Samd4b n/a
6 TRCN0000314254 GAGTCGCAGAATGTCACCAAA pLKO_005 1269 CDS 100% 4.950 3.465 N Samd4b n/a
7 TRCN0000190107 GCAACAGGAGTCCAAAGAGAA pLKO.1 473 CDS 100% 4.950 3.465 N Samd4b n/a
8 TRCN0000314253 GCAACAGGAGTCCAAAGAGAA pLKO_005 473 CDS 100% 4.950 3.465 N Samd4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03521 pDONR223 100% 92% 96.8% None (many diffs) n/a
2 ccsbBroad304_03521 pLX_304 0% 92% 96.8% V5 (many diffs) n/a
3 TRCN0000467741 TCCACCTAGTCGGGTTCTTTAGTG pLX_317 15.3% 92% 96.8% V5 (many diffs) n/a
Download CSV