Transcript: Mouse NM_175044.3

Mus musculus BCL6 interacting corepressor (Bcor), transcript variant b, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Bcor (71458)
Length:
6905
CDS:
776..6001

Additional Resources:

NCBI RefSeq record:
NM_175044.3
NBCI Gene record:
Bcor (71458)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175044.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081965 CCCGGATATTCCGTAGCAATT pLKO.1 5763 CDS 100% 10.800 15.120 N Bcor n/a
2 TRCN0000081966 CCACTTAGAAATTGTACGATT pLKO.1 5356 CDS 100% 4.950 6.930 N Bcor n/a
3 TRCN0000033460 GCCAAATAAGTATTCACTGAA pLKO.1 1402 CDS 100% 4.950 6.930 N BCOR n/a
4 TRCN0000081964 CCCAGTAGATTCCCACAGTTA pLKO.1 1666 CDS 100% 4.950 3.465 N Bcor n/a
5 TRCN0000081967 CCAGAATTTGTGACCTACCAA pLKO.1 2909 CDS 100% 3.000 2.100 N Bcor n/a
6 TRCN0000081963 CCCACTGTGTACAGTGTGTTA pLKO.1 6019 3UTR 100% 0.495 0.347 N Bcor n/a
7 TRCN0000033463 CCCACAGTGAACTTATGGAAA pLKO.1 5442 CDS 100% 4.950 3.465 N BCOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175044.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12102 pDONR223 100% 9.3% 9.4% None (many diffs) n/a
2 ccsbBroad304_12102 pLX_304 0% 9.3% 9.4% V5 (many diffs) n/a
3 TRCN0000472582 ATCCCGCCTCTGCTGCTGACCAGA pLX_317 80.3% 9.3% 9.4% V5 (many diffs) n/a
Download CSV