Transcript: Human NM_175052.3

Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ST8SIA4 (7903)
Length:
1862
CDS:
328..834

Additional Resources:

NCBI RefSeq record:
NM_175052.3
NBCI Gene record:
ST8SIA4 (7903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035209 CCAATGAAGAATCGCAGGTTT pLKO.1 724 CDS 100% 4.950 3.465 N ST8SIA4 n/a
2 TRCN0000035211 CGGACACTAAACATTTCTCAT pLKO.1 673 CDS 100% 4.950 3.465 N ST8SIA4 n/a
3 TRCN0000093937 CCTGAAGTTTCACCAATGAAA pLKO.1 712 CDS 100% 0.563 0.394 N St8sia4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07186 pDONR223 100% 99.8% 99.4% None 20G>A n/a
2 ccsbBroad304_07186 pLX_304 0% 99.8% 99.4% V5 20G>A n/a
3 TRCN0000470116 TCTGCCCACCCAGCGGGCCTGAGG pLX_317 3.8% 99.8% 99.4% V5 20G>A n/a
Download CSV