Transcript: Mouse NM_175175.4

Mus musculus pleckstrin homology domain containing, family F (with FYVE domain) member 2 (Plekhf2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Plekhf2 (71801)
Length:
2956
CDS:
242..991

Additional Resources:

NCBI RefSeq record:
NM_175175.4
NBCI Gene record:
Plekhf2 (71801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216491 GAGTGGATGAATCACATAAAT pLKO.1 602 CDS 100% 15.000 21.000 N Plekhf2 n/a
2 TRCN0000241277 TACGGAATGGATGGCTTATTA pLKO_005 528 CDS 100% 15.000 21.000 N Plekhf2 n/a
3 TRCN0000241280 AGGCGAATACTAGACGCATAA pLKO_005 267 CDS 100% 10.800 15.120 N Plekhf2 n/a
4 TRCN0000241279 ATTCTAGTATACGGCAATATT pLKO_005 422 CDS 100% 15.000 10.500 N Plekhf2 n/a
5 TRCN0000216353 GTCGTTGAAGTCTCCTTTAAA pLKO.1 928 CDS 100% 15.000 10.500 N Plekhf2 n/a
6 TRCN0000241278 TGGATATAGGTAAGCATATTT pLKO_005 1548 3UTR 100% 15.000 10.500 N Plekhf2 n/a
7 TRCN0000241281 CCGACTAGATCAGACTCTTAT pLKO_005 902 CDS 100% 13.200 9.240 N Plekhf2 n/a
8 TRCN0000192213 CGATGATGATAGCAGTGACTA pLKO.1 970 CDS 100% 4.950 3.465 N Plekhf2 n/a
9 TRCN0000136403 CGGATTTGTGACTTCTGCTAT pLKO.1 845 CDS 100% 4.950 3.465 N PLEKHF2 n/a
10 TRCN0000285507 CGGATTTGTGACTTCTGCTAT pLKO_005 845 CDS 100% 4.950 3.465 N PLEKHF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04104 pDONR223 100% 89.9% 97.5% None (many diffs) n/a
2 ccsbBroad304_04104 pLX_304 0% 89.9% 97.5% V5 (many diffs) n/a
3 TRCN0000475240 ACGACTTGCACTGCACGCAAACAT pLX_317 60.4% 89.9% 97.5% V5 (many diffs) n/a
Download CSV