Transcript: Mouse NM_175187.5

Mus musculus transmembrane protein 161B (Tmem161b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem161b (72745)
Length:
2704
CDS:
137..1600

Additional Resources:

NCBI RefSeq record:
NM_175187.5
NBCI Gene record:
Tmem161b (72745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175187.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179003 CCCTTGCCAGTGGATAATAAT pLKO.1 1361 CDS 100% 15.000 10.500 N Tmem161b n/a
2 TRCN0000172896 GCCAGTGTCATGCAGAAGATT pLKO.1 179 CDS 100% 5.625 3.938 N TMEM161B n/a
3 TRCN0000178795 CACTGCATTACTTCCCAGAAT pLKO.1 426 CDS 100% 4.950 3.465 N Tmem161b n/a
4 TRCN0000167747 GCAGAAGATTATACCTCACTA pLKO.1 190 CDS 100% 4.950 3.465 N TMEM161B n/a
5 TRCN0000184313 GCACTGCATTACTTCCCAGAA pLKO.1 425 CDS 100% 4.050 2.835 N Tmem161b n/a
6 TRCN0000183453 GCTACCATTGTCTATTTAGTA pLKO.1 476 CDS 100% 5.625 3.375 N Tmem161b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175187.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09696 pDONR223 100% 91.2% 95% None (many diffs) n/a
2 ccsbBroad304_09696 pLX_304 0% 91.2% 95% V5 (many diffs) n/a
3 TRCN0000469018 TAAAGTCATGTCAAGCCTTTAGAC pLX_317 27.9% 91.2% 95% V5 (many diffs) n/a
Download CSV