Transcript: Mouse NM_175194.2

Mus musculus solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 (Slc25a16), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Slc25a16 (73132)
Length:
3141
CDS:
120..1118

Additional Resources:

NCBI RefSeq record:
NM_175194.2
NBCI Gene record:
Slc25a16 (73132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068578 GCAATGATGATTCGGATCTTT pLKO.1 411 CDS 100% 5.625 7.875 N Slc25a16 n/a
2 TRCN0000068582 CAACCGTCATTACAAACATTT pLKO.1 320 CDS 100% 13.200 10.560 N Slc25a16 n/a
3 TRCN0000068579 GCACACCTATTCAGGGATCAT pLKO.1 614 CDS 100% 4.950 3.465 N Slc25a16 n/a
4 TRCN0000068581 GCTGTGGCTTTCACAACGTAT pLKO.1 1065 CDS 100% 4.950 3.465 N Slc25a16 n/a
5 TRCN0000068580 CCTTGAAGAGTGTTGGGCTTT pLKO.1 754 CDS 100% 4.050 2.835 N Slc25a16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13987 pDONR223 98.5% 86.6% 92.7% None (many diffs) n/a
2 ccsbBroad304_13987 pLX_304 0% 86.6% 92.7% V5 (many diffs) n/a
3 TRCN0000479042 CTGCGGCATTCATGGACTTGGAGA pLX_317 41.8% 86.6% 92.7% V5 (many diffs) n/a
Download CSV