Transcript: Mouse NM_175312.4

Mus musculus base methyltransferase of 25S rRNA 2 (Bmt2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bmt2 (101148)
Length:
4147
CDS:
134..1345

Additional Resources:

NCBI RefSeq record:
NM_175312.4
NBCI Gene record:
Bmt2 (101148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175312.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178680 CGCATTGAATGGTGTTGTAGT pLKO.1 410 CDS 100% 4.950 6.930 N Bmt2 n/a
2 TRCN0000198435 GTCGCATTGAATGGTGTTGTA pLKO.1 408 CDS 100% 4.950 6.930 N Bmt2 n/a
3 TRCN0000216849 GCACGTGTAAACGGTTATATT pLKO.1 2157 3UTR 100% 15.000 12.000 N Bmt2 n/a
4 TRCN0000216979 CCATTGCCAAAGTAGTATTTC pLKO.1 1973 3UTR 100% 13.200 10.560 N Bmt2 n/a
5 TRCN0000216129 CAGTTGTCTAAATGCAATAAA pLKO.1 2954 3UTR 100% 15.000 10.500 N Bmt2 n/a
6 TRCN0000217444 GATGTTGGCAGCTGCTTTAAT pLKO.1 635 CDS 100% 15.000 10.500 N Bmt2 n/a
7 TRCN0000198313 GCCTCAGGAAAGATCAGATTA pLKO.1 611 CDS 100% 13.200 9.240 N Bmt2 n/a
8 TRCN0000198253 GACTTGGTTAGCAGGAACTAT pLKO.1 1109 CDS 100% 5.625 3.938 N Bmt2 n/a
9 TRCN0000177303 GAGTGTGTATAAGTGTGACTT pLKO.1 715 CDS 100% 4.950 3.465 N Bmt2 n/a
10 TRCN0000198000 CCAGGGATGTTGTATATTCCT pLKO.1 1130 CDS 100% 3.000 2.100 N Bmt2 n/a
11 TRCN0000128425 GCACTTCTTTACTCTGGTAAA pLKO.1 2753 3UTR 100% 1.080 0.756 N BMT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175312.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05082 pDONR223 100% 88.8% 94% None (many diffs) n/a
2 ccsbBroad304_05082 pLX_304 0% 88.8% 94% V5 (many diffs) n/a
3 TRCN0000470064 GTCAAGTCTTCAATCTTACTTGGC pLX_317 32.3% 88.8% 94% V5 (many diffs) n/a
Download CSV