Transcript: Mouse NM_175331.3

Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nt5dc3 (103466)
Length:
5967
CDS:
106..1746

Additional Resources:

NCBI RefSeq record:
NM_175331.3
NBCI Gene record:
Nt5dc3 (103466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366661 CGAGCAATCGAAGCGGATATT pLKO_005 892 CDS 100% 13.200 18.480 N Nt5dc3 n/a
2 TRCN0000200722 GAATCCTTGATTACATCTGAT pLKO.1 2552 3UTR 100% 4.950 6.930 N Nt5dc3 n/a
3 TRCN0000376801 GCCTGTCAGACATCGAAATAT pLKO_005 374 CDS 100% 15.000 12.000 N Nt5dc3 n/a
4 TRCN0000375542 ATTACACCCTGGTATTCTATT pLKO_005 410 CDS 100% 13.200 10.560 N Nt5dc3 n/a
5 TRCN0000192741 GCATGCATGCAGAAGTGTAAA pLKO.1 2877 3UTR 100% 13.200 9.240 N Nt5dc3 n/a
6 TRCN0000366660 AGACGTCAAGGACTCCATAAG pLKO_005 843 CDS 100% 10.800 7.560 N Nt5dc3 n/a
7 TRCN0000192900 GCTGCTCTGTTATCAACAGTT pLKO.1 2618 3UTR 100% 4.950 3.465 N Nt5dc3 n/a
8 TRCN0000191707 CAGTTCTGTTTAATGGCGTTT pLKO.1 2634 3UTR 100% 4.050 2.835 N Nt5dc3 n/a
9 TRCN0000201640 CCACGTTCATTGCAAATGCCA pLKO.1 2667 3UTR 100% 0.750 0.525 N Nt5dc3 n/a
10 TRCN0000375611 TGAAGAACAACATTGACTATG pLKO_005 803 CDS 100% 10.800 6.480 N Nt5dc3 n/a
11 TRCN0000192861 GCCTTCCAGTTTGGATAGTTA pLKO.1 5248 3UTR 100% 5.625 3.375 N Nt5dc3 n/a
12 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 3908 3UTR 100% 4.950 2.475 Y Gad2 n/a
13 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3849 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03334 pDONR223 100% 85.6% 91.2% None (many diffs) n/a
2 ccsbBroad304_03334 pLX_304 0% 85.6% 91.2% V5 (many diffs) n/a
3 TRCN0000477695 TGCACGACCCTAAAAAGAGGGTAT pLX_317 8.7% 85.6% 91.2% V5 (many diffs) n/a
Download CSV