Transcript: Mouse NM_175386.3

Mus musculus lipoma HMGIC fusion partner (Lhfp), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Lhfp (108927)
Length:
2107
CDS:
417..1019

Additional Resources:

NCBI RefSeq record:
NM_175386.3
NBCI Gene record:
Lhfp (108927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125731 GAGTGGAGGATCTGTACCATA pLKO.1 657 CDS 100% 4.950 6.930 N Lhfp n/a
2 TRCN0000125730 CCGGCAGACTTGTGGCTACAT pLKO.1 860 CDS 100% 1.650 2.310 N Lhfp n/a
3 TRCN0000125729 GCCTTCAAATGTCAATGTTAT pLKO.1 1802 3UTR 100% 13.200 9.240 N Lhfp n/a
4 TRCN0000125732 GCCTGTATCCTTTGGCACTTT pLKO.1 536 CDS 100% 4.950 3.465 N Lhfp n/a
5 TRCN0000125733 GTGTACATGGATGGCTTGCTT pLKO.1 965 CDS 100% 3.000 2.100 N Lhfp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02344 pDONR223 100% 89% 97% None (many diffs) n/a
2 ccsbBroad304_02344 pLX_304 0% 89% 97% V5 (many diffs) n/a
3 TRCN0000478911 GCATGCAGTTCACATCGGATTACC pLX_317 51.9% 89% 97% V5 (many diffs) n/a
Download CSV