Transcript: Mouse NM_175436.5

Mus musculus zinc finger protein 526 (Zfp526), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Zfp526 (210172)
Length:
3375
CDS:
191..2218

Additional Resources:

NCBI RefSeq record:
NM_175436.5
NBCI Gene record:
Zfp526 (210172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175436.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096370 GAAGAGCACAATGGGTTAGAA pLKO.1 875 CDS 100% 5.625 7.875 N Zfp526 n/a
2 TRCN0000096372 GACCTTCGCTTCTTTAGCCAA pLKO.1 1726 CDS 100% 2.640 3.696 N Zfp526 n/a
3 TRCN0000096369 GCACTGTGAGATGAGAATGTA pLKO.1 3208 3UTR 100% 5.625 3.938 N Zfp526 n/a
4 TRCN0000096373 CAGGAGCAGTGGAAATCTCAA pLKO.1 237 CDS 100% 4.950 3.465 N Zfp526 n/a
5 TRCN0000096371 TGAGTGTACCACTTGCTCTAA pLKO.1 1207 CDS 100% 4.950 3.465 N Zfp526 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175436.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04693 pDONR223 100% 82.7% 86.5% None (many diffs) n/a
2 ccsbBroad304_04693 pLX_304 0% 82.7% 86.5% V5 (many diffs) n/a
3 TRCN0000479338 CTGAATCAAGCTCCCACCTTGACC pLX_317 23.5% 82.7% 86.5% V5 (many diffs) n/a
Download CSV