Transcript: Mouse NM_175497.3

Mus musculus actin, beta-like 2 (Actbl2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Actbl2 (238880)
Length:
2737
CDS:
121..1251

Additional Resources:

NCBI RefSeq record:
NM_175497.3
NBCI Gene record:
Actbl2 (238880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091429 CGCAAGTATTCGGTTTGGATT pLKO.1 1126 CDS 100% 4.950 6.930 N Actbl2 n/a
2 TRCN0000091428 CCCTTCTCTTTCATATTAGTT pLKO.1 2529 3UTR 100% 5.625 3.938 N Actbl2 n/a
3 TRCN0000091430 CCGGATGAACATCCTATTCTT pLKO.1 415 CDS 100% 5.625 3.938 N Actbl2 n/a
4 TRCN0000091431 CCTTCCTTTCTAGGCATTGAA pLKO.1 913 CDS 100% 5.625 3.938 N Actbl2 n/a
5 TRCN0000091432 GCAGAAGGAAATTGTAACCTT pLKO.1 1062 CDS 100% 3.000 2.100 N Actbl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05497 pDONR223 100% 89.4% 97% None (many diffs) n/a
2 ccsbBroad304_05497 pLX_304 0% 89.4% 97% V5 (many diffs) n/a
3 TRCN0000480996 TCGCGGAGACTCACCCAATCCCGC pLX_317 35.4% 89.4% 97% V5 (many diffs) n/a
Download CSV