Transcript: Mouse NM_175751.4

Mus musculus zinc finger protein 608 (Zfp608), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zfp608 (269023)
Length:
6112
CDS:
547..5082

Additional Resources:

NCBI RefSeq record:
NM_175751.4
NBCI Gene record:
Zfp608 (269023)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175751.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249824 AGTATGCCTACGGGCTCTATA pLKO_005 3788 CDS 100% 13.200 18.480 N Zfp608 n/a
2 TRCN0000249820 GTCCAGCCTATTCGGACATAT pLKO_005 3350 CDS 100% 13.200 18.480 N Zfp608 n/a
3 TRCN0000249821 AGGGCCATCAGTGCCTAATAA pLKO_005 4050 CDS 100% 15.000 12.000 N Zfp608 n/a
4 TRCN0000137388 GATACTTATGACAGTGGCGAT pLKO.1 598 CDS 100% 2.160 1.728 N ZNF608 n/a
5 TRCN0000249822 ATGATGACACTTGGTACAATT pLKO_005 5587 3UTR 100% 13.200 9.240 N Zfp608 n/a
6 TRCN0000249823 CCAAATACAGTTGATACTTAT pLKO_005 586 CDS 100% 13.200 9.240 N Zfp608 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175751.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08737 pDONR223 100% 89.8% 93% None (many diffs) n/a
2 ccsbBroad304_08737 pLX_304 11.1% 89.8% 93% V5 (many diffs) n/a
3 TRCN0000475830 CTGAAGCCCATCTGTCTATTACCT pLX_317 9.1% 89.8% 93% V5 (many diffs) n/a
Download CSV