Transcript: Human NM_175911.3

Homo sapiens olfactory receptor family 2 subfamily L member 13 (OR2L13), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
OR2L13 (284521)
Length:
2046
CDS:
500..1438

Additional Resources:

NCBI RefSeq record:
NM_175911.3
NBCI Gene record:
OR2L13 (284521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357636 GTCTAGGGCTATTGACCATTT pLKO_005 1006 CDS 100% 10.800 15.120 N OR2L13 n/a
2 TRCN0000009165 GCCCAGTAGTCAGTGTCTATA pLKO.1 1868 3UTR 100% 13.200 10.560 N OR2L13 n/a
3 TRCN0000009168 CCCAAATCAAACTGGAATATT pLKO.1 553 CDS 100% 15.000 10.500 N OR2L13 n/a
4 TRCN0000009169 CACCACCATTTCAACACATTT pLKO.1 1210 CDS 100% 13.200 9.240 N OR2L13 n/a
5 TRCN0000357637 TCCTGTGGCCGAGTCCTATTT pLKO_005 1145 CDS 100% 13.200 9.240 N OR2L13 n/a
6 TRCN0000009166 CCACTCTCTCTATTATCCTAT pLKO.1 877 CDS 100% 4.950 3.465 N OR2L13 n/a
7 TRCN0000009167 CCGAGTCCTATTTGCTGTCTA pLKO.1 1153 CDS 100% 4.950 3.465 N OR2L13 n/a
8 TRCN0000357566 CATGGCCTACGACCGTTATTT pLKO_005 847 CDS 100% 15.000 9.000 N OR2L13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05383 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05383 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468330 CGACATGTTATTGTGCGCTCTGGT pLX_317 44% 100% 100% V5 n/a
Download CSV