Transcript: Mouse NM_175930.5

Mus musculus Rap guanine nucleotide exchange factor (GEF) 5 (Rapgef5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rapgef5 (217944)
Length:
3987
CDS:
646..3090

Additional Resources:

NCBI RefSeq record:
NM_175930.5
NBCI Gene record:
Rapgef5 (217944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175930.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109996 GCAAGGTCTTACATCTGGTTT pLKO.1 1778 CDS 100% 4.950 6.930 N Rapgef5 n/a
2 TRCN0000109998 GCACTCCTATATCAGTGTGAA pLKO.1 2097 CDS 100% 4.950 6.930 N Rapgef5 n/a
3 TRCN0000109995 CCAGTCCAAGTTTCAGCTTAT pLKO.1 3352 3UTR 100% 10.800 7.560 N Rapgef5 n/a
4 TRCN0000109997 GCCGTCACACTGTTGATGAAT pLKO.1 1955 CDS 100% 5.625 3.938 N Rapgef5 n/a
5 TRCN0000109999 CAGAAGAAGAATAAAGCCCTT pLKO.1 1984 CDS 100% 2.160 1.512 N Rapgef5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175930.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11412 pDONR223 100% 47.2% 43.2% None (many diffs) n/a
2 ccsbBroad304_11412 pLX_304 0% 47.2% 43.2% V5 (many diffs) n/a
3 TRCN0000478426 GGGAGGCTCAGTTTGATGTATATC pLX_317 23.5% 47.2% 43.2% V5 (many diffs) n/a
Download CSV