Transcript: Mouse NM_175937.3

Mus musculus cytoplasmic polyadenylation element binding protein 2 (Cpeb2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Cpeb2 (231207)
Length:
6823
CDS:
1..3045

Additional Resources:

NCBI RefSeq record:
NM_175937.3
NBCI Gene record:
Cpeb2 (231207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175937.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000351028 ACTGCCAGCTTCCGAAGATTT pLKO_005 2320 CDS 100% 13.200 18.480 N Cpeb2 n/a
2 TRCN0000339452 TGTTATAGCACCACCGAAATT pLKO_005 1794 CDS 100% 13.200 18.480 N Cpeb2 n/a
3 TRCN0000192024 CGTCCTTGGAATTTAAGTGAT pLKO.1 2530 CDS 100% 4.950 6.930 N Cpeb2 n/a
4 TRCN0000339451 CTTCCGCTGGAACTAAGTATA pLKO_005 3030 CDS 100% 13.200 9.240 N Cpeb2 n/a
5 TRCN0000339382 CACATCCAGGAACCGACAATC pLKO_005 2105 CDS 100% 10.800 7.560 N Cpeb2 n/a
6 TRCN0000339380 CCTACATCTCAGGCTTACTAA pLKO_005 3222 3UTR 100% 5.625 3.938 N Cpeb2 n/a
7 TRCN0000192926 GCTCAGATTCACTCCAAGATA pLKO.1 1940 CDS 100% 5.625 3.938 N Cpeb2 n/a
8 TRCN0000201053 CCAGGGACTATGAATCAGATA pLKO.1 1744 CDS 100% 4.950 3.465 N Cpeb2 n/a
9 TRCN0000200685 GTCCTTGGAATTTAAGTGATA pLKO.1 2531 CDS 100% 4.950 3.465 N Cpeb2 n/a
10 TRCN0000149728 GAGTTCCATAAGCCATTGGTA pLKO.1 2977 CDS 100% 3.000 2.400 N CPEB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175937.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13173 pDONR223 100% 48.9% 51.9% None (many diffs) n/a
2 ccsbBroad304_13173 pLX_304 0% 48.9% 51.9% V5 (many diffs) n/a
3 TRCN0000477873 CAGCACTTATTCCGCAATTATGCG pLX_317 21% 48.9% 51.9% V5 (many diffs) n/a
Download CSV