Transcript: Human NM_176677.3

Homo sapiens NHL repeat containing 4 (NHLRC4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NHLRC4 (283948)
Length:
2071
CDS:
624..995

Additional Resources:

NCBI RefSeq record:
NM_176677.3
NBCI Gene record:
NHLRC4 (283948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176677.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179956 CAACTCAGAGGGCAATGTTAT pLKO.1 791 CDS 100% 13.200 9.240 N NHLRC4 n/a
2 TRCN0000264185 CAACTCAGAGGGCAATGTTAT pLKO_005 791 CDS 100% 13.200 9.240 N NHLRC4 n/a
3 TRCN0000264186 TCTAACCCTCTCCTCCCATTT pLKO_005 1796 3UTR 100% 10.800 7.560 N NHLRC4 n/a
4 TRCN0000282942 TTGCTGTGAGTGAGGAGTTTG pLKO_005 676 CDS 100% 10.800 7.560 N NHLRC4 n/a
5 TRCN0000264187 TGCCAAGGACAACTCCATCAA pLKO_005 944 CDS 100% 4.950 3.465 N NHLRC4 n/a
6 TRCN0000180030 CAACTCCATCAAGGTGTACCA pLKO.1 953 CDS 100% 2.640 1.848 N NHLRC4 n/a
7 TRCN0000180654 CAAGGACAACTCCATCAAGGT pLKO.1 947 CDS 100% 2.640 1.848 N NHLRC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176677.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05368 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05368 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465511 GCAAACATGCCGTACGGTATCAAG pLX_317 86.4% 100% 100% V5 n/a
Download CSV