Transcript: Human NM_176805.4

Homo sapiens mitochondrial ribosomal protein S11 (MRPS11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPS11 (64963)
Length:
3293
CDS:
11..496

Additional Resources:

NCBI RefSeq record:
NM_176805.4
NBCI Gene record:
MRPS11 (64963)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176805.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157810 CCAGGTAGTCTCTGCTAGTAA pLKO.1 202 CDS 100% 5.625 7.875 N MRPS11 n/a
2 TRCN0000275496 CCAGGTAGTCTCTGCTAGTAA pLKO_005 202 CDS 100% 5.625 7.875 N MRPS11 n/a
3 TRCN0000275561 CGTGATCCACATCCGAGTTGT pLKO_005 340 CDS 100% 4.950 3.960 N MRPS11 n/a
4 TRCN0000275499 GCTCCAGTGGGACCTTGTAAA pLKO_005 537 3UTR 100% 13.200 9.240 N MRPS11 n/a
5 TRCN0000156937 GCCTGGAAGTGATCTCAATCA pLKO.1 417 CDS 100% 4.950 3.465 N MRPS11 n/a
6 TRCN0000275497 GCCTGGAAGTGATCTCAATCA pLKO_005 417 CDS 100% 4.950 3.465 N MRPS11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176805.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03990 pDONR223 100% 82.9% 82.9% None 182_183ins99 n/a
2 ccsbBroad304_03990 pLX_304 0% 82.9% 82.9% V5 182_183ins99 n/a
3 TRCN0000471484 ATCCAAATGCGCGCCAGTTGCCTA pLX_317 78.5% 82.9% 82.9% V5 182_183ins99 n/a
4 ccsbBroadEn_12505 pDONR223 100% 82.4% 82.4% None 65_67delGCA;182_183ins99 n/a
5 ccsbBroad304_12505 pLX_304 0% 82.4% 82.4% V5 65_67delGCA;182_183ins99 n/a
6 TRCN0000471848 TTTCGGCTTCCCCGAACACATCAT pLX_317 87.3% 82.4% 82.4% V5 65_67delGCA;182_183ins99 n/a
Download CSV