Transcript: Human NM_176821.4

Homo sapiens NLR family pyrin domain containing 10 (NLRP10), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NLRP10 (338322)
Length:
4254
CDS:
180..2147

Additional Resources:

NCBI RefSeq record:
NM_176821.4
NBCI Gene record:
NLRP10 (338322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176821.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164449 CGAGGTACTTCAGCTCCTATT pLKO.1 1141 CDS 100% 10.800 8.640 N NLRP10 n/a
2 TRCN0000162288 CCTTGAGGAGAACGATTTCAA pLKO.1 236 CDS 100% 5.625 4.500 N NLRP10 n/a
3 TRCN0000159865 GAGAACGATTTCAAGAAGTTA pLKO.1 243 CDS 100% 5.625 3.938 N NLRP10 n/a
4 TRCN0000163678 GAAAGACAACTCTCGCCAGAA pLKO.1 712 CDS 100% 4.050 2.835 N NLRP10 n/a
5 TRCN0000158752 GATGGAATCTATGAAGCACAA pLKO.1 1832 CDS 100% 4.050 2.835 N NLRP10 n/a
6 TRCN0000164068 CTCTACAAAGCGTGTCAGGTT pLKO.1 1218 CDS 100% 2.640 1.848 N NLRP10 n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3127 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176821.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05434 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05434 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477485 ATCTTGTTATACAGTCTTCCTCGT pLX_317 12.6% 100% 100% V5 n/a
Download CSV