Transcript: Mouse NM_176840.3

Mus musculus oxysterol binding protein-like 11 (Osbpl11), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Osbpl11 (106326)
Length:
4521
CDS:
734..3007

Additional Resources:

NCBI RefSeq record:
NM_176840.3
NBCI Gene record:
Osbpl11 (106326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105196 CGCTGGCATCTAGTGGTAATT pLKO.1 1287 CDS 100% 13.200 18.480 N Osbpl11 n/a
2 TRCN0000325887 CGCTGGCATCTAGTGGTAATT pLKO_005 1287 CDS 100% 13.200 18.480 N Osbpl11 n/a
3 TRCN0000306119 CTTCGAATCCAGGCGATTATG pLKO_005 2779 CDS 100% 13.200 18.480 N Osbpl11 n/a
4 TRCN0000105199 GAGGACCGAATGATTCGATTT pLKO.1 2030 CDS 100% 10.800 15.120 N Osbpl11 n/a
5 TRCN0000325813 GAGGACCGAATGATTCGATTT pLKO_005 2030 CDS 100% 10.800 15.120 N Osbpl11 n/a
6 TRCN0000105197 GCAACTATGAACTGCTTAAAT pLKO.1 1553 CDS 100% 15.000 12.000 N Osbpl11 n/a
7 TRCN0000325814 GCAACTATGAACTGCTTAAAT pLKO_005 1553 CDS 100% 15.000 12.000 N Osbpl11 n/a
8 TRCN0000105198 GCATGTCAATAGGTGTGACAA pLKO.1 2388 CDS 100% 0.495 0.347 N Osbpl11 n/a
9 TRCN0000105195 GCTCTGAGAAACCGTTCTCTT pLKO.1 4307 3UTR 100% 0.495 0.347 N Osbpl11 n/a
10 TRCN0000354071 GCTCTGAGAAACCGTTCTCTT pLKO_005 4307 3UTR 100% 0.495 0.347 N Osbpl11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13042 pDONR223 100% 42% 44.7% None (many diffs) n/a
2 ccsbBroad304_13042 pLX_304 0% 42% 44.7% V5 (many diffs) n/a
3 TRCN0000480767 GCTGGCAATCCTATTCCCTAGAAC pLX_317 47.9% 42% 44.7% V5 (many diffs) n/a
Download CSV