Transcript: Mouse NM_176845.5

Mus musculus DDHD domain containing 1 (Ddhd1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Mus musculus (mouse)
Gene:
Ddhd1 (114874)
Length:
5099
CDS:
133..2787

Additional Resources:

NCBI RefSeq record:
NM_176845.5
NBCI Gene record:
Ddhd1 (114874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176845.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313462 ACAGATTAGAACCGTTGATTT pLKO_005 2081 CDS 100% 13.200 18.480 N Ddhd1 n/a
2 TRCN0000313463 AGCAAGAGCTGAATCGATTAT pLKO_005 1604 CDS 100% 13.200 18.480 N Ddhd1 n/a
3 TRCN0000100489 GAGATCTGTAACCGCTTACTA pLKO.1 2029 CDS 100% 5.625 7.875 N Ddhd1 n/a
4 TRCN0000317076 GAGATCTGTAACCGCTTACTA pLKO_005 2029 CDS 100% 5.625 7.875 N Ddhd1 n/a
5 TRCN0000100486 GCCTGTTGAATGGCGATCAAA pLKO.1 1443 CDS 100% 5.625 7.875 N Ddhd1 n/a
6 TRCN0000317141 GCCTGTTGAATGGCGATCAAA pLKO_005 1443 CDS 100% 5.625 7.875 N Ddhd1 n/a
7 TRCN0000100488 GCAGACTTCTCATATCGTGTT pLKO.1 1293 CDS 100% 4.050 5.670 N Ddhd1 n/a
8 TRCN0000100485 GTTCAGTTCTAAAGGAGTTAT pLKO.1 2934 3UTR 100% 13.200 10.560 N Ddhd1 n/a
9 TRCN0000313464 TTCAGTTCTAAAGGAGTTATT pLKO_005 2935 3UTR 100% 13.200 9.240 N Ddhd1 n/a
10 TRCN0000100487 CCATCTAAAGACTCACTGGAA pLKO.1 2410 CDS 100% 2.640 1.848 N Ddhd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176845.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09052 pDONR223 100% 83% 85.7% None (many diffs) n/a
2 ccsbBroad304_09052 pLX_304 0% 83% 85.7% V5 (many diffs) n/a
3 TRCN0000477591 ATTCCCAATCATCACCCGATGCTC pLX_317 18.8% 83% 85.7% V5 (many diffs) n/a
Download CSV