Transcript: Mouse NM_176847.3

Mus musculus USH1 protein network component sans (Ush1g), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Ush1g (16470)
Length:
3183
CDS:
63..1448

Additional Resources:

NCBI RefSeq record:
NM_176847.3
NBCI Gene record:
Ush1g (16470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248913 AGCAATATCACCGAGGTTATG pLKO_005 2673 3UTR 100% 10.800 15.120 N Ush1g n/a
2 TRCN0000248914 TGGTGTTTCGAAGGAACTATG pLKO_005 1006 CDS 100% 10.800 8.640 N Ush1g n/a
3 TRCN0000248915 ACATCTGGTGCCTGGACAATG pLKO_005 331 CDS 100% 10.800 7.560 N Ush1g n/a
4 TRCN0000257817 CGCTGCACATGGAAGACTTTG pLKO_005 1255 CDS 100% 10.800 7.560 N Ush1g n/a
5 TRCN0000248916 TGGGTAGTGATGTGATGTTTG pLKO_005 808 CDS 100% 10.800 7.560 N Ush1g n/a
6 TRCN0000176111 GCTCTGAATTACAAGAGGATT pLKO.1 1708 3UTR 100% 4.950 3.465 N Ush1g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04787 pDONR223 100% 90.8% 96.3% None (many diffs) n/a
2 ccsbBroad304_04787 pLX_304 0% 90.8% 96.3% V5 (many diffs) n/a
3 TRCN0000465942 TGCTTACAGAATAAAATTAACGGA pLX_317 17% 90.8% 96.3% V5 (many diffs) n/a
Download CSV