Transcript: Mouse NM_176916.4

Mus musculus phospholipase D family, member 5 (Pld5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pld5 (319455)
Length:
3571
CDS:
439..2049

Additional Resources:

NCBI RefSeq record:
NM_176916.4
NBCI Gene record:
Pld5 (319455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176916.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246416 GGCAGCTTACATCGGAAATTT pLKO_005 1779 CDS 100% 15.000 21.000 N Pld5 n/a
2 TRCN0000257525 ACCGCAGATTCAAAGGTATTA pLKO_005 1006 CDS 100% 13.200 18.480 N Pld5 n/a
3 TRCN0000246414 TCTCGTCTCTTAAAGCTATTT pLKO_005 1625 CDS 100% 13.200 18.480 N Pld5 n/a
4 TRCN0000246415 TTCGCTTTATATAGCTCATTA pLKO_005 1237 CDS 100% 13.200 18.480 N Pld5 n/a
5 TRCN0000051789 GCCTGGTCCTAGATTTACAAA pLKO.1 1211 CDS 100% 5.625 7.875 N PLD5 n/a
6 TRCN0000246417 CTGTCATGGTAGGCGATATTT pLKO_005 3396 3UTR 100% 15.000 10.500 N Pld5 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2781 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176916.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13381 pDONR223 100% 73.3% 77.4% None (many diffs) n/a
2 ccsbBroad304_13381 pLX_304 0% 73.3% 77.4% V5 (many diffs) n/a
3 TRCN0000467753 ACCCAGAAAACGTTTTATAAAGAT pLX_317 31.8% 73.3% 77.4% V5 (many diffs) n/a
Download CSV