Transcript: Mouse NM_176963.4

Mus musculus galactose mutarotase (Galm), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Galm (319625)
Length:
2245
CDS:
246..1274

Additional Resources:

NCBI RefSeq record:
NM_176963.4
NBCI Gene record:
Galm (319625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176963.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248412 AGATCGTAGCAGCCATAATAA pLKO_005 1349 3UTR 100% 15.000 21.000 N Galm n/a
2 TRCN0000217425 GATCGTAGCAGCCATAATAAT pLKO.1 1350 3UTR 100% 15.000 21.000 N Galm n/a
3 TRCN0000200937 CGACCATAATTTCTGTCTGAA pLKO.1 971 CDS 100% 4.950 6.930 N Galm n/a
4 TRCN0000201451 CCAGTTAATCTGACCAACCAT pLKO.1 753 CDS 100% 3.000 2.400 N Galm n/a
5 TRCN0000257563 CATTGCAGCAGATGCATATTT pLKO_005 830 CDS 100% 15.000 10.500 N Galm n/a
6 TRCN0000248414 GCCAAAGGAAGATTCACTATA pLKO_005 495 CDS 100% 13.200 9.240 N Galm n/a
7 TRCN0000248413 GAGTACCACCTGCCAGTTAAC pLKO_005 525 CDS 100% 10.800 7.560 N Galm n/a
8 TRCN0000248415 GTGCTTGGCTTTGCGGAATTG pLKO_005 411 CDS 100% 10.800 7.560 N Galm n/a
9 TRCN0000202426 GCTGAAAGTCTGGGTGACATA pLKO.1 674 CDS 100% 4.950 3.465 N Galm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176963.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04864 pDONR223 100% 85.5% 87.1% None (many diffs) n/a
2 ccsbBroad304_04864 pLX_304 0% 85.5% 87.1% V5 (many diffs) n/a
3 TRCN0000470053 GGCACGATCACTATGGCCTGGCGC pLX_317 47.1% 85.5% 87.1% V5 (many diffs) n/a
Download CSV