Transcript: Mouse NM_176979.5

Mus musculus topoisomerase (DNA) II binding protein 1 (Topbp1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Topbp1 (235559)
Length:
5112
CDS:
53..4600

Additional Resources:

NCBI RefSeq record:
NM_176979.5
NBCI Gene record:
Topbp1 (235559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176979.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124222 CGCTTTATATCTGTGACCGTT pLKO.1 219 CDS 100% 2.640 2.112 N Topbp1 n/a
2 TRCN0000124223 GCCAGAAGAGTTTCCTTGTTT pLKO.1 1722 CDS 100% 5.625 3.938 N Topbp1 n/a
3 TRCN0000331542 GCCAGAAGAGTTTCCTTGTTT pLKO_005 1722 CDS 100% 5.625 3.938 N Topbp1 n/a
4 TRCN0000124220 GCTCTTAGAAACTGCGAGAAT pLKO.1 2221 CDS 100% 4.950 3.465 N Topbp1 n/a
5 TRCN0000302497 GCTCTTAGAAACTGCGAGAAT pLKO_005 2221 CDS 100% 4.950 3.465 N Topbp1 n/a
6 TRCN0000124221 GCTTTATATCTGTGACCGTTT pLKO.1 220 CDS 100% 4.050 2.835 N Topbp1 n/a
7 TRCN0000302500 GCTTTATATCTGTGACCGTTT pLKO_005 220 CDS 100% 4.050 2.835 N Topbp1 n/a
8 TRCN0000124219 CCTGAATTTGAATCACTGGTT pLKO.1 4793 3UTR 100% 2.640 1.848 N Topbp1 n/a
9 TRCN0000302499 CCTGAATTTGAATCACTGGTT pLKO_005 4793 3UTR 100% 2.640 1.848 N Topbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176979.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.