Transcript: Mouse NM_177157.4

Mus musculus GTP cyclohydrolase I feedback regulator (Gchfr), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gchfr (320415)
Length:
629
CDS:
51..305

Additional Resources:

NCBI RefSeq record:
NM_177157.4
NBCI Gene record:
Gchfr (320415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177157.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098950 CCTGCCTATCTCTTTCCAAAT pLKO.1 372 3UTR 100% 10.800 7.560 N Gchfr n/a
2 TRCN0000098951 GAGAAGTGTCTTGGGAAACAA pLKO.1 158 CDS 100% 5.625 3.938 N Gchfr n/a
3 TRCN0000098953 TGTGGTGTCTGCACAAGGAAT pLKO.1 283 CDS 100% 4.950 3.465 N Gchfr n/a
4 TRCN0000050787 ATAGTCCTGGACAAGCTGGAA pLKO.1 213 CDS 100% 2.640 1.848 N GCHFR n/a
5 TRCN0000098952 CAAGCTGGAATGCAAGGGCTT pLKO.1 224 CDS 100% 2.160 1.512 N Gchfr n/a
6 TRCN0000098954 GAATACTACGTCAACGACCCT pLKO.1 186 CDS 100% 0.660 0.462 N Gchfr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177157.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00623 pDONR223 100% 91.6% 92.8% None (many diffs) n/a
2 ccsbBroad304_00623 pLX_304 0% 91.6% 92.8% V5 (many diffs) n/a
3 TRCN0000477039 ATCTGACCAGGGTTATGGTGAGTT pLX_317 100% 91.6% 92.8% V5 (many diffs) n/a
Download CSV