Transcript: Mouse NM_177236.4

Mus musculus ATPase, Ca++ transporting, plasma membrane 3 (Atp2b3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-22
Taxon:
Mus musculus (mouse)
Gene:
Atp2b3 (320707)
Length:
6748
CDS:
370..4032

Additional Resources:

NCBI RefSeq record:
NM_177236.4
NBCI Gene record:
Atp2b3 (320707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177236.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101553 CGAGGTCTTCAAAGCCGTATT pLKO.1 916 CDS 100% 10.800 15.120 N Atp2b3 n/a
2 TRCN0000101554 AGAAGTTTACTGTCATACGAA pLKO.1 947 CDS 100% 3.000 4.200 N Atp2b3 n/a
3 TRCN0000101550 GAAATGACTAACATGGCTAAA pLKO.1 4156 3UTR 100% 10.800 7.560 N Atp2b3 n/a
4 TRCN0000101551 CGCAAGTCTATGAGCACAGTT pLKO.1 2107 CDS 100% 4.950 3.465 N Atp2b3 n/a
5 TRCN0000101552 GCCCAGGTCAAATATGGAGAT pLKO.1 1018 CDS 100% 4.050 2.835 N Atp2b3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4079 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177236.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13817 pDONR223 100% 63.6% 70.4% None (many diffs) n/a
2 ccsbBroad304_13817 pLX_304 0% 63.6% 70.4% V5 (many diffs) n/a
Download CSV