Transcript: Mouse NM_177378.4

Mus musculus ring finger protein 150 (Rnf150), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnf150 (330812)
Length:
9685
CDS:
655..1968

Additional Resources:

NCBI RefSeq record:
NM_177378.4
NBCI Gene record:
Rnf150 (330812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177378.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086847 CTTCGTGAACATCACCTATTT pLKO.1 780 CDS 100% 13.200 9.240 N Rnf150 n/a
2 TRCN0000086844 CTGCACGTACAGGGATAAGAT pLKO.1 1026 CDS 100% 5.625 3.938 N Rnf150 n/a
3 TRCN0000086846 GCCTTCGTGAACATCACCTAT pLKO.1 778 CDS 100% 4.950 3.465 N Rnf150 n/a
4 TRCN0000086845 CTCCAACACAAACGAGACCAT pLKO.1 1098 CDS 100% 2.640 1.848 N Rnf150 n/a
5 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 8 5UTR 100% 15.000 7.500 Y KAAG1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2 5UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 7277 3UTR 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177378.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12349 pDONR223 100% 66% 68.1% None (many diffs) n/a
2 ccsbBroad304_12349 pLX_304 0% 66% 68.1% V5 (many diffs) n/a
3 TRCN0000473506 ACCCAGGCTATCAGGATCTATATA pLX_317 48.1% 66% 68.1% V5 (many diffs) n/a
Download CSV