Transcript: Human NM_177403.5

Homo sapiens RAB7B, member RAS oncogene family (RAB7B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
RAB7B (338382)
Length:
3029
CDS:
305..904

Additional Resources:

NCBI RefSeq record:
NM_177403.5
NBCI Gene record:
RAB7B (338382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177403.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029781 CTCATTATCGTCGGAGCCATT pLKO.1 335 CDS 100% 4.050 5.670 N RAB7B n/a
2 TRCN0000029783 AGTGCCAAGAATGACATCAAT pLKO.1 761 CDS 100% 5.625 3.938 N RAB7B n/a
3 TRCN0000029779 GCTGGTGTAGAGAGAAAGATA pLKO.1 723 CDS 100% 5.625 3.938 N RAB7B n/a
4 TRCN0000029782 CACAACTTTGAAGTTACAGAT pLKO.1 466 CDS 100% 4.950 3.465 N RAB7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177403.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05437 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05437 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480492 GAGTTGGTACACAGAGCCTTCACA pLX_317 70.9% 100% 100% V5 n/a
Download CSV