Transcript: Human NM_177533.5

Homo sapiens nudix hydrolase 14 (NUDT14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
NUDT14 (256281)
Length:
854
CDS:
104..772

Additional Resources:

NCBI RefSeq record:
NM_177533.5
NBCI Gene record:
NUDT14 (256281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177533.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051853 CGTGACCGTTCTCTTATTCAA pLKO.1 229 CDS 100% 5.625 7.875 N NUDT14 n/a
2 TRCN0000441361 ATGAAGACGCATGACAGCGTG pLKO_005 212 CDS 100% 2.160 3.024 N NUDT14 n/a
3 TRCN0000051857 CACGCTGCATTACCGCCAGAA pLKO.1 166 CDS 100% 1.350 1.890 N NUDT14 n/a
4 TRCN0000174135 CACGCTGCATTACCGCCAGAA pLKO.1 166 CDS 100% 1.350 1.890 N NUDT14 n/a
5 TRCN0000051855 CTCCAGACAGACCATGTTCTA pLKO.1 553 CDS 100% 4.950 3.465 N NUDT14 n/a
6 TRCN0000051854 GCGTCATCTTTGGTGTCTCAT pLKO.1 711 CDS 100% 4.950 3.465 N NUDT14 n/a
7 TRCN0000443340 TTCAACTCTTCTCGGAGGAGC pLKO_005 245 CDS 100% 2.160 1.512 N NUDT14 n/a
8 TRCN0000432109 CAAGACCCTCGGCGTCATCTT pLKO_005 700 CDS 100% 1.650 1.155 N NUDT14 n/a
9 TRCN0000051856 CCAGAAGTCCTGGGACTTCAT pLKO.1 193 CDS 100% 0.495 0.297 N NUDT14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177533.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05313 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05313 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468593 TTTCTTGGCTTGCACTGTGACCGC pLX_317 57.1% 100% 100% V5 n/a
Download CSV