Transcript: Mouse NM_177595.4

Mus musculus mohawk homeobox (Mkx), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mkx (210719)
Length:
3201
CDS:
238..1302

Additional Resources:

NCBI RefSeq record:
NM_177595.4
NBCI Gene record:
Mkx (210719)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177595.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085047 CCGTTACCTTAACGACTCCTT pLKO.1 912 CDS 100% 2.640 3.696 N Mkx n/a
2 TRCN0000085045 GCCTTAACAAACCTTGCCCAA pLKO.1 1177 CDS 100% 2.160 3.024 N Mkx n/a
3 TRCN0000419234 CGCTAGTGCAGGTGTCAAATT pLKO_005 575 CDS 100% 13.200 10.560 N Mkx n/a
4 TRCN0000085043 CCTGAGTTCAACTATCGTAAA pLKO.1 1416 3UTR 100% 10.800 8.640 N Mkx n/a
5 TRCN0000412971 AGACATGGCGCGTCCTCTTAA pLKO_005 474 CDS 100% 13.200 9.240 N Mkx n/a
6 TRCN0000085044 GCCAGATTTAAGTTGGGCCTT pLKO.1 639 CDS 100% 2.160 1.512 N Mkx n/a
7 TRCN0000085046 CAGATTTAAGTTGGGCCTTAA pLKO.1 641 CDS 100% 1.080 0.756 N Mkx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177595.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09934 pDONR223 100% 84.7% 88.4% None (many diffs) n/a
2 ccsbBroad304_09934 pLX_304 0% 84.7% 88.4% V5 (many diffs) n/a
3 TRCN0000473396 TTTGTCACGATCCCTGTGCTCGGG pLX_317 36% 84.7% 88.4% V5 (many diffs) n/a
Download CSV