Transcript: Mouse NM_177612.3

Mus musculus catenin (cadherin associated protein), alpha 3 (Ctnna3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ctnna3 (216033)
Length:
3609
CDS:
88..2775

Additional Resources:

NCBI RefSeq record:
NM_177612.3
NBCI Gene record:
Ctnna3 (216033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108726 CGGCTAAGAAGCCCTTGATTA pLKO.1 2645 CDS 100% 13.200 18.480 N Ctnna3 n/a
2 TRCN0000108725 GCGCTTGATGATAATCAGTTT pLKO.1 1885 CDS 100% 4.950 6.930 N Ctnna3 n/a
3 TRCN0000108729 CCATCACTAGAGAAACGCCTA pLKO.1 979 CDS 100% 2.160 3.024 N Ctnna3 n/a
4 TRCN0000108728 GCTTGTTCCATGTCAACGAAT pLKO.1 1381 CDS 100% 4.950 3.465 N Ctnna3 n/a
5 TRCN0000108727 GCAGTTACAAGACTCCTTGTT pLKO.1 478 CDS 100% 0.495 0.347 N Ctnna3 n/a
6 TRCN0000159368 GAGATTGAGATATGGGATGAT pLKO.1 2155 CDS 100% 4.950 2.475 Y CTNNA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11900 pDONR223 100% 49.4% 52% None (many diffs) n/a
2 ccsbBroad304_11900 pLX_304 0% 49.4% 52% V5 (many diffs) n/a
3 TRCN0000477633 TCCCACACCATACCTCTGCGGCTA pLX_317 18% 49.4% 52% V5 (many diffs) n/a
Download CSV