Transcript: Mouse NM_177699.4

Mus musculus formin homology 2 domain containing 1 (Fhod1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fhod1 (234686)
Length:
3951
CDS:
118..3711

Additional Resources:

NCBI RefSeq record:
NM_177699.4
NBCI Gene record:
Fhod1 (234686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177699.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248947 CCGATCTCTCTTCTCATTAAA pLKO_005 525 CDS 100% 15.000 21.000 N Fhod1 n/a
2 TRCN0000248950 AGACCCGTGGTCGCATGATTA pLKO_005 3239 CDS 100% 13.200 18.480 N Fhod1 n/a
3 TRCN0000192602 GCCATGTTAAGAGTAGTGCAT pLKO.1 3034 CDS 100% 2.640 2.112 N Fhod1 n/a
4 TRCN0000248949 GAAAGCATGGAGCGGGAAATT pLKO_005 2584 CDS 100% 13.200 9.240 N Fhod1 n/a
5 TRCN0000216791 GAACCTCTTTCCTACCATTTC pLKO.1 1383 CDS 100% 10.800 7.560 N Fhod1 n/a
6 TRCN0000248948 TGAACCTCTTTCCTACCATTT pLKO_005 1382 CDS 100% 10.800 7.560 N Fhod1 n/a
7 TRCN0000201435 CCTGGAACAGAAACCTGGTTT pLKO.1 3770 3UTR 100% 4.950 3.465 N Fhod1 n/a
8 TRCN0000257842 CTGGACATGACAGCGACATAC pLKO_005 3725 3UTR 100% 10.800 8.640 N Fhod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177699.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08115 pDONR223 100% 82.7% 85.8% None (many diffs) n/a
2 ccsbBroad304_08115 pLX_304 0% 82.7% 85.8% V5 (many diffs) n/a
3 TRCN0000481039 TACATGCCACTTTCTCCCTTTAGG pLX_317 10.5% 82.7% 85.8% V5 (many diffs) n/a
Download CSV