Transcript: Mouse NM_177730.3

Mus musculus inositol monophosphatase domain containing 1 (Impad1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Impad1 (242291)
Length:
4636
CDS:
204..1274

Additional Resources:

NCBI RefSeq record:
NM_177730.3
NBCI Gene record:
Impad1 (242291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177730.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174471 CCCGTACTTAACAGTATGTAA pLKO.1 2771 3UTR 100% 5.625 7.875 N Impad1 n/a
2 TRCN0000293056 CCCGTACTTAACAGTATGTAA pLKO_005 2771 3UTR 100% 5.625 7.875 N Impad1 n/a
3 TRCN0000193411 CCTGTGTTAGGAGTTATTCAT pLKO.1 801 CDS 100% 5.625 7.875 N Impad1 n/a
4 TRCN0000194089 GATGTGCCTGATATGACTCAA pLKO.1 1029 CDS 100% 4.950 6.930 N Impad1 n/a
5 TRCN0000215851 CTATATATTCATGTGACATAC pLKO.1 1062 CDS 100% 10.800 8.640 N Impad1 n/a
6 TRCN0000175469 CCGTTCTTCCTACAATGAGAA pLKO.1 881 CDS 100% 4.950 3.465 N Impad1 n/a
7 TRCN0000293114 CCGTTCTTCCTACAATGAGAA pLKO_005 881 CDS 100% 4.950 3.465 N Impad1 n/a
8 TRCN0000174472 CCAGATAATATGACAGGAGAA pLKO.1 2927 3UTR 100% 4.050 2.835 N Impad1 n/a
9 TRCN0000293115 CCAGATAATATGACAGGAGAA pLKO_005 2927 3UTR 100% 4.050 2.835 N Impad1 n/a
10 TRCN0000173584 GCCTGGAATATGCTAGGGAAT pLKO.1 3857 3UTR 100% 4.050 2.835 N Impad1 n/a
11 TRCN0000293116 GCCTGGAATATGCTAGGGAAT pLKO_005 3857 3UTR 100% 4.050 2.835 N Impad1 n/a
12 TRCN0000217204 CTTCTTGCTAGCATCAGAATG pLKO.1 1200 CDS 100% 10.800 6.480 N Impad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177730.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03485 pDONR223 100% 89.1% 91% None (many diffs) n/a
2 ccsbBroad304_03485 pLX_304 0% 89.1% 91% V5 (many diffs) n/a
3 TRCN0000478011 CAGCGGAAAGTCAGCTAAGTACGA pLX_317 46.7% 89.1% 91% V5 (many diffs) n/a
Download CSV