Transcript: Mouse NM_177834.4

Mus musculus carboxypeptidase A6 (Cpa6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cpa6 (329093)
Length:
1940
CDS:
219..1535

Additional Resources:

NCBI RefSeq record:
NM_177834.4
NBCI Gene record:
Cpa6 (329093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177834.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221510 CGGTCAAGAGACTCTAAGTTT pLKO.1 990 CDS 100% 5.625 7.875 N Cpa6 n/a
2 TRCN0000221511 CTGCCAGAGATGCTCATTAAA pLKO.1 1446 CDS 100% 15.000 10.500 N Cpa6 n/a
3 TRCN0000221514 CAGATGTTGCTATATCCTTAT pLKO.1 1203 CDS 100% 10.800 7.560 N Cpa6 n/a
4 TRCN0000221512 GCCTCCCAAACACTGTATGTA pLKO.1 1332 CDS 100% 5.625 3.938 N Cpa6 n/a
5 TRCN0000221513 CACATGATAGATTCTGGAGAA pLKO.1 964 CDS 100% 4.050 2.835 N Cpa6 n/a
6 TRCN0000047003 CCCAGCAGTATCTCCTATGTA pLKO.1 426 CDS 100% 5.625 3.938 N CPA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177834.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08696 pDONR223 100% 86.2% 84.2% None (many diffs) n/a
2 ccsbBroad304_08696 pLX_304 0% 86.2% 84.2% V5 (many diffs) n/a
3 TRCN0000480628 TGCGGCATATCCTATAACCGCCCT pLX_317 29.3% 86.2% 84.2% V5 (many diffs) n/a
Download CSV