Transcript: Human NM_177969.3

Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1B (PPM1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PPM1B (5495)
Length:
1829
CDS:
488..1066

Additional Resources:

NCBI RefSeq record:
NM_177969.3
NBCI Gene record:
PPM1B (5495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002450 GACTGAATCCACATAGAGAAA pLKO.1 732 CDS 100% 4.950 3.465 N PPM1B n/a
2 TRCN0000318500 GACTGAATCCACATAGAGAAA pLKO_005 732 CDS 100% 4.950 3.465 N PPM1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01255 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01255 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479066 GCCTTGTTTCACATTTAGACTTAT pLX_317 66.4% 100% 100% V5 n/a
Download CSV