Transcript: Human NM_178011.5

Homo sapiens leucine rich repeat transmembrane neuronal 3 (LRRTM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
LRRTM3 (347731)
Length:
6049
CDS:
549..2294

Additional Resources:

NCBI RefSeq record:
NM_178011.5
NBCI Gene record:
LRRTM3 (347731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178011.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432876 GCCGAATCAGTGACCATAAAC pLKO_005 2260 CDS 100% 13.200 18.480 N LRRTM3 n/a
2 TRCN0000129608 CCTTCGCTATAACAGCCTTCA pLKO.1 749 CDS 100% 4.050 3.240 N LRRTM3 n/a
3 TRCN0000128201 CCTTTACTTGCAGTGGAATAA pLKO.1 1247 CDS 100% 13.200 9.240 N LRRTM3 n/a
4 TRCN0000422900 TCAGCTGTAGCACTGGTTATA pLKO_005 582 CDS 100% 13.200 9.240 N LRRTM3 n/a
5 TRCN0000129106 CGAGCACATCTCTTTCCATAA pLKO.1 1784 CDS 100% 10.800 7.560 N LRRTM3 n/a
6 TRCN0000193762 CTGTCTTACTGACAATGCTTT pLKO.1 610 CDS 100% 4.950 3.465 N Lrrtm3 n/a
7 TRCN0000131077 GCCCAGAAACCTTGACTCTAA pLKO.1 2785 3UTR 100% 4.950 3.465 N LRRTM3 n/a
8 TRCN0000128916 GCCTAGTTTCTAAGCAGTGAA pLKO.1 3022 3UTR 100% 4.950 3.465 N LRRTM3 n/a
9 TRCN0000130410 GCCTTGAATTACAGCCTAGTT pLKO.1 3009 3UTR 100% 4.950 3.465 N LRRTM3 n/a
10 TRCN0000194335 CTCTCCCATAAGTCCTTTGAA pLKO.1 2166 CDS 100% 5.625 3.375 N Lrrtm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178011.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05510 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05510 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479720 CTTTCCGCTTTTATGCACTCAATT pLX_317 21.8% 100% 100% V5 n/a
Download CSV