Transcript: Mouse NM_178080.4

Mus musculus phosphodiesterase 4D interacting protein (myomegalin) (Pde4dip), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pde4dip (83679)
Length:
6200
CDS:
417..3773

Additional Resources:

NCBI RefSeq record:
NM_178080.4
NBCI Gene record:
Pde4dip (83679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178080.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262999 TGACCTTCAGAGCGCTCTATT pLKO_005 1931 CDS 100% 13.200 10.560 N Pde4dip n/a
2 TRCN0000217182 CAAACCGATCAAGGTTCTATG pLKO.1 3045 CDS 100% 10.800 8.640 N Pde4dip n/a
3 TRCN0000262998 GAAGAAGCCTGGAGCGTTTAA pLKO_005 3676 CDS 100% 13.200 9.240 N Pde4dip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178080.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07462 pDONR223 100% 84.3% 85.1% None (many diffs) n/a
2 ccsbBroad304_07462 pLX_304 0% 84.3% 85.1% V5 (many diffs) n/a
3 TRCN0000473671 ATACATCCAACTTCAGTAGTATCG pLX_317 9.4% 84.3% 85.1% V5 (many diffs) n/a
Download CSV