Transcript: Human NM_178310.4

Homo sapiens snail family transcriptional repressor 3 (SNAI3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SNAI3 (333929)
Length:
1740
CDS:
102..980

Additional Resources:

NCBI RefSeq record:
NM_178310.4
NBCI Gene record:
SNAI3 (333929)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178310.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033299 GCGTGTCTTCACCTGCAAGTA pLKO.1 641 CDS 100% 4.950 3.960 N SNAI3 n/a
2 TRCN0000033303 AGACAGCCTGAACCACCTCAA pLKO.1 419 CDS 100% 4.050 2.835 N SNAI3 n/a
3 TRCN0000033302 GAGAAATCAATGGTGCCTGCT pLKO.1 175 CDS 100% 2.160 1.512 N SNAI3 n/a
4 TRCN0000033301 GCAAACGCACTCAGACGCCAA pLKO.1 869 CDS 100% 0.720 0.504 N SNAI3 n/a
5 TRCN0000033300 GAGACGCAGAGAGAAATCAAT pLKO.1 165 CDS 100% 5.625 3.375 N SNAI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178310.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05425 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05425 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478255 ACTTGGCAGCTGTTAGTTGCCTTT pLX_317 37.9% 100% 100% V5 n/a
Download CSV