Transcript: Human NM_178348.2

Homo sapiens late cornified envelope 1A (LCE1A), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
LCE1A (353131)
Length:
625
CDS:
1..333

Additional Resources:

NCBI RefSeq record:
NM_178348.2
NBCI Gene record:
LCE1A (353131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243982 CTAAGTGCCCTCCAGTCTCTT pLKO_005 104 CDS 100% 4.950 2.475 Y LCE1A n/a
2 TRCN0000262784 TAAGTGCCCTCCAGTCTCTTC pLKO_005 105 CDS 100% 4.050 2.025 Y LCE1D n/a
3 TRCN0000243981 AGTCTCTTCCTGCTGCAGTGT pLKO_005 117 CDS 100% 2.640 1.320 Y LCE1A n/a
4 TRCN0000262783 TCTCTTCCTGCTGCAGTGTCA pLKO_005 119 CDS 100% 2.640 1.320 Y LCE1D n/a
5 TRCN0000257212 CAGTGTCAGCTCCGGAGGCTG pLKO_005 132 CDS 100% 0.000 0.000 Y LCE1A n/a
6 TRCN0000243980 CCCAAGTGCCCTCCCAAGTGC pLKO_005 52 CDS 100% 0.000 0.000 Y LCE1A n/a
7 TRCN0000257210 GGCTGCTGTGGCTCCAGCTCT pLKO_005 148 CDS 100% 0.000 0.000 Y LCE1A n/a
8 TRCN0000243065 GTCAGCTCCGGAGGCTGCTGT pLKO_005 136 CDS 100% 0.000 0.000 Y LCE1F n/a
9 TRCN0000262782 GTGTCAGCTCCGGAGGCTGCT pLKO_005 134 CDS 100% 0.000 0.000 Y LCE1D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05520 pDONR223 100% 87.2% 85.5% None (many diffs) n/a
2 ccsbBroad304_05520 pLX_304 0% 87.2% 85.5% V5 (many diffs) n/a
3 TRCN0000473334 TCTCCACCCTGTCCCCAATCTTTT pLX_317 100% 87.2% 85.5% V5 (many diffs) n/a
Download CSV