Transcript: Mouse NM_178399.4

Mus musculus RIKEN cDNA 3110035E14 gene (3110035E14Rik), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
3110035E14Rik (76982)
Length:
3187
CDS:
318..941

Additional Resources:

NCBI RefSeq record:
NM_178399.4
NBCI Gene record:
3110035E14Rik (76982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178399.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264283 TCGGTAACATAGACCTTATAT pLKO_005 2501 3UTR 100% 15.000 21.000 N 3110035E14Rik n/a
2 TRCN0000264280 AGCCGACTAAACTCGACATTT pLKO_005 932 CDS 100% 13.200 18.480 N 3110035E14Rik n/a
3 TRCN0000191404 CGCATGAATTAAGCTATTCTT pLKO.1 2207 3UTR 100% 5.625 7.875 N 3110035E14Rik n/a
4 TRCN0000121598 CACAAGAAGAAGTCTGAATAT pLKO.1 885 CDS 100% 13.200 9.240 N VXN n/a
5 TRCN0000192679 GCACAAGAAGAAGTCTGAATA pLKO.1 884 CDS 100% 13.200 9.240 N 3110035E14Rik n/a
6 TRCN0000264282 GCACAAGAAGAAGTCTGAATA pLKO_005 884 CDS 100% 13.200 9.240 N 3110035E14Rik n/a
7 TRCN0000264281 CTGTGTGGGAATCGAGCATAT pLKO_005 633 CDS 100% 10.800 7.560 N 3110035E14Rik n/a
8 TRCN0000282966 TGGCTAGGATCTCGGTGAAAG pLKO_005 676 CDS 100% 10.800 7.560 N 3110035E14Rik n/a
9 TRCN0000190263 CTTCCAAGGTGTCCAGTTCAT pLKO.1 376 CDS 100% 4.950 3.465 N 3110035E14Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178399.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10481 pDONR223 100% 83.6% 82.2% None (many diffs) n/a
2 ccsbBroad304_10481 pLX_304 0% 83.6% 82.2% V5 (many diffs) n/a
3 TRCN0000477900 CCCAATGTTACCCCCAAGCTGTAG pLX_317 57.2% 83.6% 82.2% V5 (many diffs) n/a
Download CSV