Transcript: Human NM_178463.4

Homo sapiens MIR1-1 host gene (MIR1-1HG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MIR1-1HG (128826)
Length:
1220
CDS:
780..1133

Additional Resources:

NCBI RefSeq record:
NM_178463.4
NBCI Gene record:
MIR1-1HG (128826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165797 CAGCCCTGAAATGTCCATTAC pLKO.1 902 CDS 100% 10.800 7.560 N MIR1-1HG n/a
2 TRCN0000159439 GAAATGTCCATTACTCACAAA pLKO.1 909 CDS 100% 4.950 3.465 N MIR1-1HG n/a
3 TRCN0000166000 GCCCTGAAATGTCCATTACTC pLKO.1 904 CDS 100% 4.950 3.465 N MIR1-1HG n/a
4 TRCN0000189414 CTCTTTGTCAATGCTGAGGCA pLKO.1 963 CDS 100% 0.660 0.462 N MIR1-1HG n/a
5 TRCN0000187307 CTTTGTCAATGCTGAGGCATT pLKO.1 965 CDS 100% 0.405 0.284 N MIR1-1HG n/a
6 TRCN0000166001 GAAGTTCAGCACATCTGTGCT pLKO.1 1040 CDS 100% 0.264 0.158 N MIR1-1HG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04849 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04849 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469431 CGACTCTTGCTAGTTCCGAGAGGC pLX_317 100% 100% 100% V5 n/a
Download CSV