Transcript: Mouse NM_178590.4

Mus musculus inhibitor of kappaB kinase gamma (Ikbkg), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ikbkg (16151)
Length:
6811
CDS:
157..1392

Additional Resources:

NCBI RefSeq record:
NM_178590.4
NBCI Gene record:
Ikbkg (16151)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178590.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088812 AGACTACGACAGCCACATTAA pLKO.1 870 CDS 100% 13.200 9.240 N Ikbkg n/a
2 TRCN0000302309 AGACTACGACAGCCACATTAA pLKO_005 870 CDS 100% 13.200 9.240 N Ikbkg n/a
3 TRCN0000088811 GTAGCCAAACAGGAATTGATT pLKO.1 955 CDS 100% 5.625 3.938 N Ikbkg n/a
4 TRCN0000302306 GTAGCCAAACAGGAATTGATT pLKO_005 955 CDS 100% 5.625 3.938 N Ikbkg n/a
5 TRCN0000088808 CCACACTTAAGGGCTTGCTTT pLKO.1 1471 3UTR 100% 4.950 3.465 N Ikbkg n/a
6 TRCN0000302372 CCACACTTAAGGGCTTGCTTT pLKO_005 1471 3UTR 100% 4.950 3.465 N Ikbkg n/a
7 TRCN0000088809 GCTCCTGATATGGACACTCTA pLKO.1 1342 CDS 100% 4.950 3.465 N Ikbkg n/a
8 TRCN0000022146 GCAGCACAAGATTGTGATGGA pLKO.1 999 CDS 100% 2.640 1.848 N IKBKG n/a
9 TRCN0000088810 GCCTTAAAGGAGTTGGAGCAA pLKO.1 517 CDS 100% 2.640 1.848 N Ikbkg n/a
10 TRCN0000302371 GCCTTAAAGGAGTTGGAGCAA pLKO_005 517 CDS 100% 2.640 1.848 N Ikbkg n/a
11 TRCN0000022147 GAGAATCAAGAGCTCCGAGAT pLKO.1 325 CDS 100% 4.050 2.835 N IKBKG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178590.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01945 pDONR223 100% 83.3% 86.3% None (many diffs) n/a
2 ccsbBroad304_01945 pLX_304 16.3% 83.3% 86.3% V5 (many diffs) n/a
3 TRCN0000472009 CACGCCGCGCATTCCGTCTACAAC pLX_317 35% 83.3% 86.3% V5 (many diffs) n/a
Download CSV