Transcript: Mouse NM_178710.3

Mus musculus salt inducible kinase 2 (Sik2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sik2 (235344)
Length:
3561
CDS:
199..2994

Additional Resources:

NCBI RefSeq record:
NM_178710.3
NBCI Gene record:
Sik2 (235344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362139 CAAGACGGAGGTGGCTATAAA pLKO_005 324 CDS 100% 15.000 21.000 N Sik2 n/a
2 TRCN0000362215 GTCTCAGCTGCAAGCATATTT pLKO_005 2379 CDS 100% 15.000 10.500 N Sik2 n/a
3 TRCN0000362216 CTTGTTGGTGGAACGTCTAAA pLKO_005 1191 CDS 100% 13.200 9.240 N Sik2 n/a
4 TRCN0000037495 GCTGGATAACAACATGAATAT pLKO.1 645 CDS 100% 13.200 9.240 N SIK2 n/a
5 TRCN0000024285 CCCTCACAATTGCAGCAACAT pLKO.1 2641 CDS 100% 4.950 3.465 N Sik2 n/a
6 TRCN0000024287 CCTAGCACCATTGCTGAACAA pLKO.1 1267 CDS 100% 4.950 3.465 N Sik2 n/a
7 TRCN0000024284 CCTTATTTCATGTCAGAAGAT pLKO.1 907 CDS 100% 4.950 3.465 N Sik2 n/a
8 TRCN0000024286 CCGTCCATTGGAGAATTTAAT pLKO.1 1069 CDS 100% 15.000 9.000 N Sik2 n/a
9 TRCN0000024288 CCTGGACTCTTTGATTGTGAA pLKO.1 2911 CDS 100% 4.950 2.970 N Sik2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491648 CATACTACTGGGATGTCGTAAAGT pLX_317 10.9% 88.3% 90.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488010 CTAAGCAGGACAGCTGATGCTCGG pLX_317 10.9% 88.1% 90.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491575 ATCTTATCATTACAAAACACTGAC pLX_317 12.6% 88.1% 90.6% V5 (many diffs) n/a
Download CSV